Artículo de original - SOMEFAN

Monitoring microcystin-LR-producing cyanobacterial bloom in La Purísima Dam in Guanajuato, Mexico

Monitoreo de floración cianobacteriana productora de microcistina-LR en la Presa La Purísima en Guanajuato, México

Laura Valdés Santiago1*, Juan G. Colli Mull2, José Luis Castro Guillén2, Rosalba Alonso-Rodríguez3, Jorge Noé García Chávez4, Alejandro Zúñiga Zúñiga2, Paulette Mathieu González2, María José León Hernández2

1 SECIHTI-Tecnológico Nacional de México/Instituto Tecnológico Superior de Irapuato. Carretera Irapuato Silao km 12.5, Irapuato, C.P. 36821. Guanajuato, México.
1Tecnológico Nacional de México/Instituto Tecnológico Superior de Irapuato. Carretera Irapuato Silao km 12.5, Irapuato, C.P. 36821. Guanajuato, México. División: Ingeniería Bioquímica
1Unidad Académica Mazatlán del Instituto de Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México, P.O Box 811, Mazatlán C.P. 82000. Sinaloa, México.
1Langebio, Unidad de Genómica Avanzada, Centro de Investigación y Estudios Avanzados del Instituto Politécnico Nacional km 9.6 Libramiento Norte Irapuato-León, Irapuato, C.P. 36821. Guanajuato, México.

Email: laura.valdes@secihti.mx

Valdés Santiago, L., J.G. Colli Mull, J.L. Castro Guillén, R. Alonso-Rodríguez, J.N. García Chávez, A. Zúñiga Zúñiga, P.M. González y M.J. León Hernández. 2025. Monitoring microcystin-LR-producing cyanobacterial bloom in La Purísima Dam in Guanajuato, Mexico. Cymbella 11 (2-3): 115-120.
DOI: https://doi.org/10.22201/fc.24488100e.2025.11.2.2

ABSTRACT

Toxic cyanobacterial blooms are a growing concern due to their increasing frequency. The presence of cyanotoxins, classified as emerging contaminants, in freshwater sources poses a serious threat to aquatic ecosystems and human health. Assessing cyanotoxin levels in water bodies is essential to safeguard public well-being and ensure the continued availability of this vital resource. In Guanajuato, the water from dams and reservoirs is primarily used for crop irrigation, as well as for recreational activities and fishing. La Purísima Dam is a Protected Natural Area with a background of eutrophication and home to migratory birds. This study reports the presence of PlanktothrixMicrocystis and Raphidiopsis. The genes mcyC, mcyD, cyrA, and sxtA, which are involved in the synthesis of microcystins, cylindrospermopsin and saxitoxin, were detected at DNA level, and MC-LR was quantified.

Key words: cyanotoxins, Cylindrospermopsin, reservoirs, Planktothrix, saxitoxin.


RESUMEN

Las floraciones tóxicas de cianobacterias son una preocupación creciente debido a su incremento. La presencia de cianotoxinas, clasificadas como contaminantes emergentes, en fuentes de agua dulce representa una seria amenaza tanto para los ecosistemas acuáticos como para la salud humana. Conocer los niveles de cianotoxinas en los cuerpos de agua es esencial para garantizar el bienestar público y la disponibilidad de este recurso vital. En Guanajuato, el agua de presas y embalses se utiliza principalmente para el riego de cultivos vegetales, así como para actividades recreativas y pesca. La presa La Purísima es un Área Natural Protegida con antecedentes de eutrofización y es hábitat de aves migratorias. Este estudio reporta la presencia de los géneros de cianobacterias PlanktothrixMicrocystis y Raphidiopsis. Adicionalmente, los genes mcyC, mcyD, cyrA, y sxtA, que están involucrados en la síntesis de microcistinas, cilindrospermopsinas y saxitoxina se detectaron a nivel de ADN y se cuantificó la MC-LR.

Palabras clave: cyanotoxinas, Cylindrospermopsina, embalses, Planktothrix, saxitoxina.


INTRODUCTION

Cyanobacterial blooms are a growing global concern due to their ability to produce cyanotoxins, specialized metabolites harmful to both ecosystems and public health. Some cyanobacterial species can synthesize a wide variety of toxins, which are classified according to the primary organ they affect: hepatotoxins (e.g., microcystins), neurotoxins (e.g., anatoxins and saxitoxins), cytotoxins, and dermotoxins (Chorus & Welker 2021). Microcystin-LR (MC-LR), the most studied and prevalent variant, is particularly hazardous due its stability in water, resistance to conventional water treatment, and ability to bioaccumulate in aquatic food webs (Akbar et al. 2022; Zhang et al. 2023).

Recreational activities in water bodies such as dams represent a significant route of human exposure to cyanotoxin through ingestion, skin contact, or inhalation of aerosolized particles. Such exposure to cyanotoxin has been linked to liver damage, gastrointestinal disorders, and potential long-term carcinogenic effects (Chorus & Welker 2021; Graham et al. 2020). At the same time, eutrophication driven by anthropogenic nutrient inputs, along with climate change-related factors like increased temperature and light availability, strongly favors the formation and persistence of cyanobacterial blooms (López-Hernández et al. 2022; Paerl & Otten 2013).

Human activities in water reservoirs contribute to the proliferation of cyanobacterial blooms, adversely affecting water quality and public health. Therefore, it is imperative to establish monitoring protocols for the prevention and remediation of cyanotoxin contamination.

In Mexico, the National Water Commission has defined 757 hydrological basins, organized into 37 hydrological regions, grouped into 13 hydrological-administrative regions. The state of Guanajuato, located in hydrological regions 12 and 26, comprises nine major dams that are vital for various human activities, including agriculture, livestock, fishing, industry, domestic use, electricity generation, and the preservation of protected flora and fauna (Sistema Nacional de Información del Agua 2024). Knowing the cyanotoxin content in water bodies is essential to ensure public welfare and the availability of this vital liquid (Paerl & Otten 2013; Zahra et al. 2020).

Despite their importance, technical reports studies that evaluate the presence of cyanobacteria and cyanotoxins in Guanajuato´s reservoirs are notably scarce, particularly those involving molecular detection techniques or toxin quantification. Given the high ecological and social value of these water bodies, systematic monitoring protocols are essential not only to mitigate risks to human and animal health, but also to inform water management policies and conservation strategies (Rodríguez et al. 2024).

This study aims to fill this knowledge gap by monitoring cyanobacterial blooms and Microcystin-LR levels in Purísima Dam, an artificial reservoir of ecological significance in Guanajuato, Mexico, using morphological identification, molecular tools, and toxin quantification assays.

METHODOLOGY

For the sample collection, preservation, and transportation procedures, the protocol outlined by NOM-230-SSA1-2002 was followed. Sterile glass containers with ground-glass stopper were used to collect the samples from a surface body, the flask was submerged in the water with the neck pointing downward to a depth of 15 to 30 cm. The sampling was conducted on March 11, 2024. Collected point locations were MLP1: 20° 53’ 41” N, 101° 16’ 49” W (20.894722, -101.280278); MLP2: 20° 53’ 45” N, -101° 16’ 45” W (20.895833, -101.279167); MLP3: 20° 52’ 20” N, -101° 17’ 34” W (20.872222, -101.292778); MLP4: 20° 52’ 09” N, -101° 17’ 28” W (20.869167, -101.291111).

Morphological identification and quantification were performed using a compound microscope (Leica DMLS) following the key guidelines of Komárek & Anagnostidis (1999). Cell counts were conducted using Sedgwick-Rafter chamber, as outlined by APHA (2017).

For microcystin quantification, samples were analyzed using the Microcystin ADDA ELISA kit, following the manufacturer’s instructions (Abraxis Eurofins® product #520011OH).

Before pelleted cells from environmental samples, 400 mL of the sample was homogenized and poured into an ultrasonic sonicator, treated for 90 seconds at 42 kHz. Aliquots of 50 mL were then centrifuged at 5,200 rpm for 10 minutes. The supernatant was decanted, and this procedure was repeated until a pellet of at least 50 mg wet weight was obtained. The cell pellets were stored at -70 °C before use. Genomic DNA was extracted using the DNA mini-prep kit (Zymo Research) according to the instructions of the manufacturer. Amplification of genes 16S, mcyE, cyrA and sxtA by PCR technique was performed with the Dream Taq super mix reaction mixture (Thermo Scientific) with oligos 16SF (AGCCACACTGGGACTGAGACA), 16SR (TCGCCCATTGCGGAAA), mcyF

(AATAAATCATAATTTAGAACSGGVGATTTAGG), mcyR (AATAAATCATAACGRBTVADTTGRTATTCAATTTCT), cyrF (GTCTGCCCACGTGATGTTATGAT), cyrR (CGTGACCGCCGTGACA); sxtF (GGAGTGGATTTCAACACCAGAA), sxtR (GTTTCCCAGACTCGTTTCAGG) (Al-Tebrineh et al. 2012), with the following program: an initial denaturation for 5 min at 95 °C, followed by 25 cycles at 94 °C for 1 min, 53.6 °C for 50 s, and 72 °C for 2 min, with a final extension step at 72 °C for 5 min. The PCR products were observed using 1 % agarose gel electrophoresis, staining, and visualized.

RESULTS

The La Purísima Dam area is part of the Silao-Romita aquifer. This dam receives effluents from Guanajuato rivers. Chapín and Trinidad rivers supplies water for irrigation. Samples were collected from four points around the dam, specifically in areas with greater green coloration, the presence of scum, and the locations of water pumps. Locations MLP1 and MLP2 are near to the Molinero community, where a strong fishy odor was detected in the area, that could be associated with the presence of geosmin, a compound linked to cyanobacterial blooms (Fig. 1A-1C). The MLP2 sampling point was notable because residents were pumping water from this location for irrigation for cultivating coriander and zucchini (Fig. 1C). At the MLP3 sampling point, scum was observed and MLP4 sample was taken near the water pump that supplies water to cultivation land (Fig. 1D, 1E). At the collection sample time, La Purísima dam was medium, with a fill percentage of 54 % relative to the ordinary maximum water level.

Microscopic inspection revealed 11 different species, including Chlamydomonas sp.Trichodesmium sp., Trachelomonas sp., Lemmernannia tetrapediaNitzschia sp., Mesodinium rubrumScenedesmus sp., Zygnema sp., Monoraphidium capricornutumOscillatoria sp. and Eudorina elegans were identified (Table 1) according to morphological criteria. Cyanobacteria with toxic potential, such as Planktothrix as the dominant microcystin-producing genus co-occurring with Microcystis and, to lesser extent, Raphidiopsis, were also observed, as confirmed by methagenomics 16S (data not shown).

Regions of cyanotoxin synthesis gene clusters were amplified by PCR to detect toxigenic genotypes. mcyC for microcystin synthesis, cyrA for cylindrospermopsin synthesis and sxtA for saxitoxin synthesis gene (Al-Tebrineh et al. 2012). From all point samples, a PCR product was amplified corresponding to the molecular weight of each cyanotoxin biosynthesis gene. Thus, indicate the presence of the genes and genotype capacity for toxin production (Fig. 1F). The results for the concentration of MC-LR were below detection limit (0.1 ppb), indicating minimal microcystin levels in the water samples. Specifically, the concentrations were as follows: MLP1 and MLP2: 0.06 ppb; MLP3: 0.21 ppb; MLP4: 0.05 ppb. The lower detection limit was 0.56 ppb therefore, no significant MC-LR production was occurring.

DISCUSSION

On November 25, 2005, declared the area known as La Purísima Dam and its surrounding zone as a Protected Natural Area (ANP) in the Sustainable Used category by Mexican Government Decree No. 249. This designation, requested by the Civil Association Colonos y Usuarios de la Presa La Purísima, A. C., and the State Ecology Institute, recognized the ecological relevance of the site due to its high aquatic biodiversity and its role in sustaining migratory bird population and aquatic life (Periódico Oficial 188). In addition to its ecological value, La Purísima serves as a recreational area and receives water inputs from the Guanajuato, Chapín and Trinidad rivers.

This dam supplies water to Irrigation District No. 11 and supports a wide range of aquatic species that are harvested for human consumption. However, irrigation with water contaminated by cyanobacteria poses a significant public health risk. Cyanotoxins produced during toxic blooms can adversely affect soil microbial communities, bioaccumulate in plant tissues, and ultimately enter the food chain, reaching fruits and vegetables consumed by the population (Bouaïcha & Corbel 2016; Levizou et al. 2020; Machado et al. 2017).

One of the persistent issues in La Purísima dam is its eutrophic condition, exacerbated by untreated domestic and agricultural waste, elevated temperatures, and poor water circulation (Tirado et al. 2023). These factors collectively promote phytoplankton growth and increase the frequency of cyanobacteria blooms, as confirmed in the present study (Table 1).

Our monitoring from 2021 to 2024 has consistently documented eutrophic conditions and the presence of potentially toxigenic cyanobacteria. The genera PlanktothrixRaphidiopsisOscillatoriaMicrocystis, and Anabaena/Dolichospermum have been recurrently identified, all of which are known microcystin producers and are among the most common genera responsible for cyanotoxin blooms worldwide (De Alavision et al. 2023).

Quantification of microcystin-LR (MC-LR) across different years showed the following concentrations: 0.42 ppb (μg/L) in 2021; 0.30 ppb in 2022 (to be published); and 0.21 ppb in 2024 (this study). These levels, while below the World Health Organization´s guideline value for drinking water (1 μg/L), indicate a persistent presence of cyanotoxins. Notably, these concentrations are up to ten times lower than those reported for other artificial reservoirs (Rodríguez et al. 2024), yet their chronic presence may still pose risks for long-term human exposure and ecosystem health.

Molecular analysis by PCR confirmed the presence of gene clusters responsible for the synthesis of microcystins (mcyC), cylindrospermopsins (cyrA), and saxitoxins (stxA) (Fig. 1F), supporting the toxigenic potential of the cyanobacterial community. These findings along with previous metagenomics data (unpublished), which detected PlanktothrixMicrocystis and Raphidiopsis as dominant genera in the reservoir.

Given these results, it is essential to implement routine molecular and chemical monitoring of La Purísima Dam to detect early signs of toxigenic blooms and prevent potential health impacts. The integration of molecular tools like PCR and quantitative toxin assays (e.g. ELISA) into local water management protocols can serve as an early warning system.

Finally, this study represents a contribution to the understanding of cyanobacterial contamination in freshwater bodies of Guanajuato. To our knowledge, this is the first report to provide a comprehensive assessment combining field observations, morphotaxonomic identification, molecular detection of toxin genes, and quantification of MC-LR in La Purísima Dam an ecosystem of ecological and social importance for the region.

CONCLUSIONS

Nontoxigenic cyanobacterial bloom containing the general PlanktothrixMicrocystis and Raphidiopsis was found in La Purísima Dam. Genes involved in the production of microcystin, cylindrospermopsin and saxitoxin were detected by PCR. However, MC-LR level suggests that gene expression was not active at enough level to be detected, or it is post-transcriptionally or post-traductionally regulated.


ACKNOWLEDGMENTS

We gratefully acknowledge financial support from UNAM-PAPIIT (IN113925) and Proyectos de Investigación Científica y Desarrollo Tecnológico e Innovación TecNM 2025 (22380.25-PD).


REFERENCES

Akbar, S., S. Iqbal, M. Azam, M.A. Mehmood, & N. Shahid. 2022. A comprehensive review on microcystin-LR toxicity, detection, and removal strategies: Water safety under threat. Environmental Advances 10: 100306. DOI: https://doi.org/10.1016/j.envadv.2022.100306

Al-Tebrineh, J., L.A. Pearson, S.A. Yasar, & B.A. Neilan. 2012. A multiplex qPCR targeting hepato- and neurotoxigenic cyanobacteria of global significance. Harmful Algae 15: 9–25. DOI: https://doi.org/10.1016/j.hal.2011.11.001

APHA. 2017. Counting cell (Sedgwick-Rafter) In: Standard Methods for the Examination of Water and Wastewater. 23rd ed. American Public Health Association, Washington.

Bouaïcha, N., & S. Corbel. 2016. Cyanobacterial toxins as emerging contaminants in soils: A review of sources, fate and impacts on ecosystems, plants and animal and human health. In: M.L. Larramendy & S. Soloneski. Eds. Soil Contamination - Current Consequences and Further Solutions. 1st ed. InTechOpen. DOI: https://doi.org/10.5772/64940

Chorus, I., & M. Welker (Eds.). 2021. Toxic Cyanobacteria in Water. 2nd edition. CRC Press, Boca Raton, on behalf of the World Health Organization, Geneva.

De Alavision, M., C. Reynolds, & T. Creswell. 2023. Harmful cyanobacterial blooms: Going beyond the “green” narrative. Hydrology & Water Management 3: 1-20. DOI: https://doi.org/10.3390/hydrolwater3010012

Komárek, J., & K. Anagnostidis. 1999. Cyanoprokaryota. 1. Chroococcales. In: H. Ettl, G. Gärtner, H. Heynig & D. Mollenhauer. Eds. Süßwasserflora von Mitteleuropa, Band 19/1: Spektrum, Akademischer Verlag, Heidelberg & Berlin.

Graham, J.L., K.A. Loftin, & M.T. Meyer. 2020. Cyanotoxin mixtures and their effects on human health: Understanding complex exposures. Toxins 12: 248. DOI: https://doi.org/10.3390/toxins12040248

Levizou, E., T. Papadimitriou, E. Papavasileiou, N. Papadimitriou, & K.A. Kormas. 2020. Root vegetables bioaccumulate microcystins-LR in a developmental stage-dependent manner under realistic exposure scenario: The case of carrot and radish. Agricultural Water Management 240: 106274. DOI: https://doi.org/10.1016/j.agwat.2020.106274

López-Hernández, J.E., J. Morales-Ventura, & O. Peña-Navarro. 2022. Climatic and nutrient drivers of cyanobacterial blooms in subtropical reservoirs: A case study from Central Mexico. Water Research 212: 118112. DOI: https://doi.org/10.1016/j.watres.2022.118112

Machado, J., A. Campos, V. Vasconcelos, & M. Freitas. 2017. Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health. Environmental Research 153: 191-204. DOI: https://doi.org/10.1016/j.envres.2016.09.015

Paerl, H., & T. Otten. 2013. Harmful cyanobacterial blooms: Causes, consequences, and controls. Microbial Ecology 65: 995-1010. DOI: https://doi.org/10.1007/s00248-012-0159-y

Periódico Oficial del Gobierno del Estado de Guanajuato. 2005. Decreto por el que se declara Área Natural Protegida la presa La Purísima. Recuperado de https://www.ordenjuridico.gob.mx/Estatal/GUANAJUATO/Municipios/Irapuato/IraDec01.pdf

Rodriguez Uro, V.H., J. Azevedo, M.J. Araújo, R. Silva, J. Bedoya, B. Paredes, C. Ranilla, V. Vasconcelos, & A. Campos. 2024. New report of cyanobacteria and cyanotoxins in El Pañe reservoir: A threat for water quality in high-Andean sources from Peru. Toxins 16: 378. DOI: https://doi.org/10.3390/toxins16090378

Sistema Nacional de Información del Agua. 2024. Situación de los recursos hídricos. Gobierno de México. Accesible en: https://sinav30.conagua.gob.mx:8080/

Tirado, D., G. Vázquez, C. Patlan, O. Estrasa, & B. García. 2023. Análisis de la calidad del agua para consumo humano en la presa “La Purísima”, Guanajuato, Gto. Universidad de Guanajuato. Volumen 21 XXVIII Verano de la Ciencia. Accesible en: https://www.jovenesenlaciencia.ugto.mx/index.php/jovenesenlaciencia/article/download/3988/3472/13069.

Zahra, Z., D. Choo, H. Lee, & A. Parveen. 2020. Cyanobacteria: Review of current potentials and applications. Environments 7: 13. DOI: https://doi.org/10.3390/environments7020013

Zhang, D., J. Tang, L. Zhuang, W. Chen, & Q. Zeng. 2023. Environmental behavior and risks of microcystin-LR: A review of current understanding. Science of the Total Environment 873: 162210. DOI: https://doi.org/10.1016/j.scitotenv.2023.162210

Sometido: 26 de febrero de 2025
Revisado: 4 de junio de 2025
Corregido: 16 de julio de 2025
Aceptado:18 de septiembre de 2025

Image01
Image01

Diseño es propiedad intelectual de www.meridion.mx